rabbit polyclonal antibodies (Novus Biologicals)
Structured Review
Rabbit Polyclonal Antibodies, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 95/100, based on 164 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rabbit+polyclonal+anti+53bp1/53BP1+Antibody/pm41290707-215-70-76
Average 95 stars, based on 164 article reviews
Images
Related Articles
Blocking Assay:Article Title: A Reporter Platform to Study Therapy-Induced Senescence in Live Cancer Cells. Article Snippet: .. Following this, cells were washed once with blocking solution (1xDPBS+0.5% (w/v) BSA+0.15% (w/v) glycine (SigmaAldrich, G7126)), followed by overnight incubation at 4 °C with the primary antibodies diluted in blocking solution: rabbit polyclonal anti-histone H3K9me3 (1:500 dilution, GTX121677, GeneTex); rabbit polyclonal antilamin B1 (1:200 dilution, ab16048, Abcam); mousemonoclonal anti-lamin A/C (1:100 dilution, 4777, Cell Signaling Technology); Article Title: Novel post-acquisition image processing to attenuate red blood cell autofluorescence for quantitative image analysis. Article Snippet: Quantitative analysis of microscopy images from samples stained with fluorescent probes necessitates a very low fluorescence background signal.. In tissues prepared by immersion in a chemical fixative, followed by conventional processing for paraffin embedding, red blood cell autofluorescence across several imaging channels can be a nuisance.. Although many protocols have been proposed to suppress red blood cell autofluorescence prior to microscopy imaging, in many instances they may not prove totally effective. Incubation:Article Title: A Reporter Platform to Study Therapy-Induced Senescence in Live Cancer Cells. Article Snippet: .. Following this, cells were washed once with blocking solution (1xDPBS+0.5% (w/v) BSA+0.15% (w/v) glycine (SigmaAldrich, G7126)), followed by overnight incubation at 4 °C with the primary antibodies diluted in blocking solution: rabbit polyclonal anti-histone H3K9me3 (1:500 dilution, GTX121677, GeneTex); rabbit polyclonal antilamin B1 (1:200 dilution, ab16048, Abcam); mousemonoclonal anti-lamin A/C (1:100 dilution, 4777, Cell Signaling Technology); Article Title: Article Snippet: .. Coverslips were incubated with primary mouse monoclonal anti-γH2AX (SER139) (Upstate) and Article Title: Novel post-acquisition image processing to attenuate red blood cell autofluorescence for quantitative image analysis. Article Snippet: Quantitative analysis of microscopy images from samples stained with fluorescent probes necessitates a very low fluorescence background signal.. In tissues prepared by immersion in a chemical fixative, followed by conventional processing for paraffin embedding, red blood cell autofluorescence across several imaging channels can be a nuisance.. Although many protocols have been proposed to suppress red blood cell autofluorescence prior to microscopy imaging, in many instances they may not prove totally effective. Western Blot:Article Title: Bora, CEP192 and Cenexin activate different Plk1 pools and regulate distinct cell and centrosome cycle transitions Article Snippet: All the siRNA sequences used in the study were previously validated sequences: siControl (Qiagen, GGACCTGGAGGTCTGCTGT), siBora (Dharmacon, TAACTAGTCCTTCGCCTATTT) 71, siCep192 (Dharmacon, AAGGAAGACATTTTCATCTCTTT), siCenexin (Dharmacon, GGCACAACATCGAGCGCAT), siCyclin A2 SMARTpool (Dharmacon, GGAAATGGAGGTTAAATGT, TAGCAGAGTTTGTGTACAT, ATGAGGATATTCACACATA, TGATAGATGCTGACCCATA), siAurora-A (Dharmacon, ATGCCCTGTCTTACTGTCA), siPlk1 (Dharmacon, CGAGCTGCTTAATGACGAG), siSeparase (Dharmacon, GCTTGTGATGCCATCCTGA) 75. .. Antibodies: The following antibodies were used in this study: Mouse anti-α-tubulin (Geneva antibody facility: AA345-M2a; 1:250: ExM) 76, Mouse anti-β-tubulin (Geneva antibody facility: AA344-M2a; 1:250: ExM) 76, Mouse monoclonal anti-α-tubulin (Clone: DM1α, Sigma Aldrich, T9026, 1:5000: Western Blotting), Rabbit polyclonal anti-Bora (gift from Erich Nigg, 1:1000 Western blotting), Rabbit polyclonal anti-CEP192 (Bethyl: A302-324A, 1:1000 Western blotting), Rabbit polyclonal anti-Cenexin (abcam: ab43840, 1:1000 Western blotting) , Mouse monoclonal anti-Aurora A (Clone 4/IAK1, BD Biosciences: 610939, 1:1000 Western blotting), Mouse monoclonal anti-Plk1 (Clone: 36-298, abcam: ab17057, 1:1000 Page 11/32 Western blotting), Rabbit polyclonal anti-Pericentrin (abcam: ab4448; 1:250: ExM, 1:2000: IF), Mouse monoclonal anti-Cyclin A2 (Clone: E32.1, abcam: ab38; 1:1000: Western Blotting), Chicken polyclonal anti-GFP (Thermo-Fisher Scienti c: A10262; 1:2000 IF), Mouse monoclonal anti-Centrin (Clone: 20H5, Merck Millipore: 04-1624 ; 1:1500 IF), Concentration Assay:Article Title: Novel post-acquisition image processing to attenuate red blood cell autofluorescence for quantitative image analysis. Article Snippet: Quantitative analysis of microscopy images from samples stained with fluorescent probes necessitates a very low fluorescence background signal.. In tissues prepared by immersion in a chemical fixative, followed by conventional processing for paraffin embedding, red blood cell autofluorescence across several imaging channels can be a nuisance.. Although many protocols have been proposed to suppress red blood cell autofluorescence prior to microscopy imaging, in many instances they may not prove totally effective. other:Article Title: TRF1 and TRF2 form distinct shelterin subcomplexes at telomeres Article Snippet: Rabbit polyclonal anti-53BP1 , Article Title: Human SKI component SKIV2L regulates telomeric DNA-RNA hybrids and prevents telomere fragility Article Snippet: |
