Review



rabbit polyclonal antibodies  (Novus Biologicals)


Bioz Verified Symbol Novus Biologicals is a verified supplier
Bioz Manufacturer Symbol Novus Biologicals manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95

    Structured Review

    Novus Biologicals rabbit polyclonal antibodies
    Rabbit Polyclonal Antibodies, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 95/100, based on 164 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rabbit+polyclonal+anti+53bp1/53BP1+Antibody/pm41290707-215-70-76
    Average 95 stars, based on 164 article reviews
    rabbit polyclonal antibodies - by Bioz Stars, 2026-09
    95/100 stars

    Images

    Related Articles

    Blocking Assay:

    Article Title: A Reporter Platform to Study Therapy-Induced Senescence in Live Cancer Cells.
    Article Snippet: .. Following this, cells were washed once with blocking solution (1xDPBS+0.5% (w/v) BSA+0.15% (w/v) glycine (SigmaAldrich, G7126)), followed by overnight incubation at 4 °C with the primary antibodies diluted in blocking solution: rabbit polyclonal anti-histone H3K9me3 (1:500 dilution, GTX121677, GeneTex); rabbit polyclonal antilamin B1 (1:200 dilution, ab16048, Abcam); mousemonoclonal anti-lamin A/C (1:100 dilution, 4777, Cell Signaling Technology); rabbit polyclonal anti-53BP1 (1:1000 dilution, NB100-904, Novus Biologicals); mouse monoclonal anti-phosphoHistoneH2A.X (Ser139), clone JBW301 (1:1000 dilution, 05–636, Merck Millipore) and rabbit polyclonal anti-Geminin (1:400 dilution, 10802-1-AP, Proteintech). .. Washing steps with 0.1% (v/v) Triton X-100 were repeated, followed by a 1 h incubation at room temperature incubation (dark) with the secondary antibodies: goat anti-rabbit Alexa Fluor 488 IgGH+L (1:1000 dilution, ab150077); goat anti-mouse Alexa Fluor 488 IgG H+L (1:1000 dilution, ab150113) and goat anti-rabbit Alexa Fluor 555 IgGH+L (1:1000 dilution, ab150078) (Abcam).

    Article Title: Novel post-acquisition image processing to attenuate red blood cell autofluorescence for quantitative image analysis.
    Article Snippet: Quantitative analysis of microscopy images from samples stained with fluorescent probes necessitates a very low fluorescence background signal.. In tissues prepared by immersion in a chemical fixative, followed by conventional processing for paraffin embedding, red blood cell autofluorescence across several imaging channels can be a nuisance.. Although many protocols have been proposed to suppress red blood cell autofluorescence prior to microscopy imaging, in many instances they may not prove totally effective.

    Incubation:

    Article Title: A Reporter Platform to Study Therapy-Induced Senescence in Live Cancer Cells.
    Article Snippet: .. Following this, cells were washed once with blocking solution (1xDPBS+0.5% (w/v) BSA+0.15% (w/v) glycine (SigmaAldrich, G7126)), followed by overnight incubation at 4 °C with the primary antibodies diluted in blocking solution: rabbit polyclonal anti-histone H3K9me3 (1:500 dilution, GTX121677, GeneTex); rabbit polyclonal antilamin B1 (1:200 dilution, ab16048, Abcam); mousemonoclonal anti-lamin A/C (1:100 dilution, 4777, Cell Signaling Technology); rabbit polyclonal anti-53BP1 (1:1000 dilution, NB100-904, Novus Biologicals); mouse monoclonal anti-phosphoHistoneH2A.X (Ser139), clone JBW301 (1:1000 dilution, 05–636, Merck Millipore) and rabbit polyclonal anti-Geminin (1:400 dilution, 10802-1-AP, Proteintech). .. Washing steps with 0.1% (v/v) Triton X-100 were repeated, followed by a 1 h incubation at room temperature incubation (dark) with the secondary antibodies: goat anti-rabbit Alexa Fluor 488 IgGH+L (1:1000 dilution, ab150077); goat anti-mouse Alexa Fluor 488 IgG H+L (1:1000 dilution, ab150113) and goat anti-rabbit Alexa Fluor 555 IgGH+L (1:1000 dilution, ab150078) (Abcam).

    Article Title:
    Article Snippet: .. Coverslips were incubated with primary mouse monoclonal anti-γH2AX (SER139) (Upstate) and rabbit polyclonal anti-53BP1 (Novus Biologicals) antibodies (1:100) for 1 h at 37 °C, washed with PBS, and incubated with secondary Alexa 488 and Alexa 594 conjugated anti-mouse (1:100) and anti-rabbit (1:200) antibodies, respectively, for 1 h at 37 °C. .. The coverslips were washed with PBS and mounted on glass slides using Vectashield mounting medium containing DAPI (Vector Laboratories) to counterstain DNA.

    Article Title: Novel post-acquisition image processing to attenuate red blood cell autofluorescence for quantitative image analysis.
    Article Snippet: Quantitative analysis of microscopy images from samples stained with fluorescent probes necessitates a very low fluorescence background signal.. In tissues prepared by immersion in a chemical fixative, followed by conventional processing for paraffin embedding, red blood cell autofluorescence across several imaging channels can be a nuisance.. Although many protocols have been proposed to suppress red blood cell autofluorescence prior to microscopy imaging, in many instances they may not prove totally effective.

    Western Blot:

    Article Title: Bora, CEP192 and Cenexin activate different Plk1 pools and regulate distinct cell and centrosome cycle transitions
    Article Snippet: All the siRNA sequences used in the study were previously validated sequences: siControl (Qiagen, GGACCTGGAGGTCTGCTGT), siBora (Dharmacon, TAACTAGTCCTTCGCCTATTT) 71, siCep192 (Dharmacon, AAGGAAGACATTTTCATCTCTTT), siCenexin (Dharmacon, GGCACAACATCGAGCGCAT), siCyclin A2 SMARTpool (Dharmacon, GGAAATGGAGGTTAAATGT, TAGCAGAGTTTGTGTACAT, ATGAGGATATTCACACATA, TGATAGATGCTGACCCATA), siAurora-A (Dharmacon, ATGCCCTGTCTTACTGTCA), siPlk1 (Dharmacon, CGAGCTGCTTAATGACGAG), siSeparase (Dharmacon, GCTTGTGATGCCATCCTGA) 75. .. Antibodies: The following antibodies were used in this study: Mouse anti-α-tubulin (Geneva antibody facility: AA345-M2a; 1:250: ExM) 76, Mouse anti-β-tubulin (Geneva antibody facility: AA344-M2a; 1:250: ExM) 76, Mouse monoclonal anti-α-tubulin (Clone: DM1α, Sigma Aldrich, T9026, 1:5000: Western Blotting), Rabbit polyclonal anti-Bora (gift from Erich Nigg, 1:1000 Western blotting), Rabbit polyclonal anti-CEP192 (Bethyl: A302-324A, 1:1000 Western blotting), Rabbit polyclonal anti-Cenexin (abcam: ab43840, 1:1000 Western blotting) , Mouse monoclonal anti-Aurora A (Clone 4/IAK1, BD Biosciences: 610939, 1:1000 Western blotting), Mouse monoclonal anti-Plk1 (Clone: 36-298, abcam: ab17057, 1:1000 Page 11/32 Western blotting), Rabbit polyclonal anti-Pericentrin (abcam: ab4448; 1:250: ExM, 1:2000: IF), Mouse monoclonal anti-Cyclin A2 (Clone: E32.1, abcam: ab38; 1:1000: Western Blotting), Chicken polyclonal anti-GFP (Thermo-Fisher Scienti c: A10262; 1:2000 IF), Mouse monoclonal anti-Centrin (Clone: 20H5, Merck Millipore: 04-1624 ; 1:1500 IF), Rabbit polyclonal anti-53BP1 (Novus Biologicals: NB100-304: 1:2000 IF), Mouse monoclonal anti-γ-tubulin (Clone: GTU-88, Sigma Aldrich: T6557, 1:2000 IF), Mouse monoclonal anti-PCNA (Clone: PC10, Santacruz Biotechnology, SC-56), Mouse monoclonal anti-γ-H2AX pSer139 (Clone: JBW301, Merck Millipore, 05-636) and Mouse monoclonal anti-Separase (abcam: ab16170; 1:500 Western blotting). .. All the Alexa Fluor-conjugated secondary antibodies were purchased from Thermo-Fisher Scienti c and used at 1:500 dilution.

    Concentration Assay:

    Article Title: Novel post-acquisition image processing to attenuate red blood cell autofluorescence for quantitative image analysis.
    Article Snippet: Quantitative analysis of microscopy images from samples stained with fluorescent probes necessitates a very low fluorescence background signal.. In tissues prepared by immersion in a chemical fixative, followed by conventional processing for paraffin embedding, red blood cell autofluorescence across several imaging channels can be a nuisance.. Although many protocols have been proposed to suppress red blood cell autofluorescence prior to microscopy imaging, in many instances they may not prove totally effective.

    other:

    Article Title: TRF1 and TRF2 form distinct shelterin subcomplexes at telomeres
    Article Snippet: Rabbit polyclonal anti-53BP1 , Novus , CatNB100-304; RRID: AB_10003037.

    Article Title: Human SKI component SKIV2L regulates telomeric DNA-RNA hybrids and prevents telomere fragility
    Article Snippet: Rabbit polyclonal anti-53BP1 , Novus Biologicals , Cat#NB 100-304, RRID: AB_350221.



    Similar Products

    96
    Bethyl rabbit polyclonal anti 53bp1
    Rabbit Polyclonal Anti 53bp1, supplied by Bethyl, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rabbit+polyclonal+anti+53bp1/53BP1+Antibody/bio_rxiv__64898__2026__03__16__711577-202-4-7
    Average 96 stars, based on 1 article reviews
    rabbit polyclonal anti 53bp1 - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    95
    Novus Biologicals rabbit polyclonal antibodies
    Rabbit Polyclonal Antibodies, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rabbit+polyclonal+anti+53bp1/53BP1+Antibody/pm41290707-215-70-76
    Average 95 stars, based on 1 article reviews
    rabbit polyclonal antibodies - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    96
    Novus Biologicals rabbit polyclonal antibodies for 53bp1
    A Number of γ-H2AX foci. Cells were fixed and stained with an antibody against γ-H2AX. Representative images are shown. 15–24 cells for each cell were analyzed and displayed as box and dot plots in the right graph. Data from different cells are shown in different colors. P -value was obtained using the Mann-Whitney U -test. B Rates of cells with <t>53BP1</t> nuclear bodies. Cells were fixed and stained with an antibody against 53BP1. Representative images were shown (arrowheads). 95–138 cells for each cell were analyzed. P -value was obtained using the Welch’s t -test. C Rates of cells with ultrafine bridges. Cells were treated with RO-3306 for 12 h, released and fixed after 1 h, and stained with an antibody against PICH (ERCC6L). A representative image is shown (arrowheads). 46–66 cells were counted for each cell. P -value was obtained using the Student’s t -test. D Chromosome breaks were observed in 50–105 metaphase chromosome spreads for each cell. A representative image is shown (arrowhead). Percentages of cells with chromosome breaks were shown in the right graph. P -value was obtained using the Student’s t -test. E Replication fork speed. Cells were sequentially pulse-labeled with digoxigenin-conjugated deoxyuridine and biotin-conjugated deoxyuridine. Representative fibers are shown. Fork speeds were determined through the length of both labels (digoxigenin-dUTPs + biotin-dUTPs), according to the previous report that 1 μm is approximately equal to 3.5 kb of DNA . 101–138 fibers per cell were quantified and shown as box and dot blots. P -value was obtained using the Mann–Whitney U test. F Replication fork asymmetry. Cells were treated as in (E). Representative fibers are shown. Fork asymmetry was determined by dividing longer biotin-dUTPs label on a bi-directional replication fork with shorter biotin-dUTPs label for 49-79 fibers per cell and shown as box and dot blots. P -value was obtained using the Mann–Whitney U test. In all the graphs, red, blue, or black-filled circles represent skin fibroblasts, while yellow-filled circles represent lung fibroblasts. Error bars represent S.D. DNA was stained with DAPI. Scale bars: 5 μm.
    Rabbit Polyclonal Antibodies For 53bp1, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rabbit+polyclonal+anti+53bp1/53BP1+Antibody+-+BSA+Free/pmc12749110-370-35-40
    Average 96 stars, based on 1 article reviews
    rabbit polyclonal antibodies for 53bp1 - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    93
    Novus Biologicals rabbit polyclonal anti 53bp1
    A Number of γ-H2AX foci. Cells were fixed and stained with an antibody against γ-H2AX. Representative images are shown. 15–24 cells for each cell were analyzed and displayed as box and dot plots in the right graph. Data from different cells are shown in different colors. P -value was obtained using the Mann-Whitney U -test. B Rates of cells with <t>53BP1</t> nuclear bodies. Cells were fixed and stained with an antibody against 53BP1. Representative images were shown (arrowheads). 95–138 cells for each cell were analyzed. P -value was obtained using the Welch’s t -test. C Rates of cells with ultrafine bridges. Cells were treated with RO-3306 for 12 h, released and fixed after 1 h, and stained with an antibody against PICH (ERCC6L). A representative image is shown (arrowheads). 46–66 cells were counted for each cell. P -value was obtained using the Student’s t -test. D Chromosome breaks were observed in 50–105 metaphase chromosome spreads for each cell. A representative image is shown (arrowhead). Percentages of cells with chromosome breaks were shown in the right graph. P -value was obtained using the Student’s t -test. E Replication fork speed. Cells were sequentially pulse-labeled with digoxigenin-conjugated deoxyuridine and biotin-conjugated deoxyuridine. Representative fibers are shown. Fork speeds were determined through the length of both labels (digoxigenin-dUTPs + biotin-dUTPs), according to the previous report that 1 μm is approximately equal to 3.5 kb of DNA . 101–138 fibers per cell were quantified and shown as box and dot blots. P -value was obtained using the Mann–Whitney U test. F Replication fork asymmetry. Cells were treated as in (E). Representative fibers are shown. Fork asymmetry was determined by dividing longer biotin-dUTPs label on a bi-directional replication fork with shorter biotin-dUTPs label for 49-79 fibers per cell and shown as box and dot blots. P -value was obtained using the Mann–Whitney U test. In all the graphs, red, blue, or black-filled circles represent skin fibroblasts, while yellow-filled circles represent lung fibroblasts. Error bars represent S.D. DNA was stained with DAPI. Scale bars: 5 μm.
    Rabbit Polyclonal Anti 53bp1, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rabbit+polyclonal+anti+53bp1/53BP1+Antibody+-+BSA+Free/pm41159617-321-56-62
    Average 93 stars, based on 1 article reviews
    rabbit polyclonal anti 53bp1 - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Novus Biologicals rabbit polyclonal anti 53bp1 antibody
    A Number of γ-H2AX foci. Cells were fixed and stained with an antibody against γ-H2AX. Representative images are shown. 15–24 cells for each cell were analyzed and displayed as box and dot plots in the right graph. Data from different cells are shown in different colors. P -value was obtained using the Mann-Whitney U -test. B Rates of cells with <t>53BP1</t> nuclear bodies. Cells were fixed and stained with an antibody against 53BP1. Representative images were shown (arrowheads). 95–138 cells for each cell were analyzed. P -value was obtained using the Welch’s t -test. C Rates of cells with ultrafine bridges. Cells were treated with RO-3306 for 12 h, released and fixed after 1 h, and stained with an antibody against PICH (ERCC6L). A representative image is shown (arrowheads). 46–66 cells were counted for each cell. P -value was obtained using the Student’s t -test. D Chromosome breaks were observed in 50–105 metaphase chromosome spreads for each cell. A representative image is shown (arrowhead). Percentages of cells with chromosome breaks were shown in the right graph. P -value was obtained using the Student’s t -test. E Replication fork speed. Cells were sequentially pulse-labeled with digoxigenin-conjugated deoxyuridine and biotin-conjugated deoxyuridine. Representative fibers are shown. Fork speeds were determined through the length of both labels (digoxigenin-dUTPs + biotin-dUTPs), according to the previous report that 1 μm is approximately equal to 3.5 kb of DNA . 101–138 fibers per cell were quantified and shown as box and dot blots. P -value was obtained using the Mann–Whitney U test. F Replication fork asymmetry. Cells were treated as in (E). Representative fibers are shown. Fork asymmetry was determined by dividing longer biotin-dUTPs label on a bi-directional replication fork with shorter biotin-dUTPs label for 49-79 fibers per cell and shown as box and dot blots. P -value was obtained using the Mann–Whitney U test. In all the graphs, red, blue, or black-filled circles represent skin fibroblasts, while yellow-filled circles represent lung fibroblasts. Error bars represent S.D. DNA was stained with DAPI. Scale bars: 5 μm.
    Rabbit Polyclonal Anti 53bp1 Antibody, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rabbit+polyclonal+anti+53bp1/53BP1+Antibody+%5BAllophycocyanin%5D/pm25849366__ja513117p_si_001-41-8-12
    Average 93 stars, based on 1 article reviews
    rabbit polyclonal anti 53bp1 antibody - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    96
    Cell Signaling Technology Inc rabbit polyclonal 53bp1 cell signaling technology
    A Number of γ-H2AX foci. Cells were fixed and stained with an antibody against γ-H2AX. Representative images are shown. 15–24 cells for each cell were analyzed and displayed as box and dot plots in the right graph. Data from different cells are shown in different colors. P -value was obtained using the Mann-Whitney U -test. B Rates of cells with <t>53BP1</t> nuclear bodies. Cells were fixed and stained with an antibody against 53BP1. Representative images were shown (arrowheads). 95–138 cells for each cell were analyzed. P -value was obtained using the Welch’s t -test. C Rates of cells with ultrafine bridges. Cells were treated with RO-3306 for 12 h, released and fixed after 1 h, and stained with an antibody against PICH (ERCC6L). A representative image is shown (arrowheads). 46–66 cells were counted for each cell. P -value was obtained using the Student’s t -test. D Chromosome breaks were observed in 50–105 metaphase chromosome spreads for each cell. A representative image is shown (arrowhead). Percentages of cells with chromosome breaks were shown in the right graph. P -value was obtained using the Student’s t -test. E Replication fork speed. Cells were sequentially pulse-labeled with digoxigenin-conjugated deoxyuridine and biotin-conjugated deoxyuridine. Representative fibers are shown. Fork speeds were determined through the length of both labels (digoxigenin-dUTPs + biotin-dUTPs), according to the previous report that 1 μm is approximately equal to 3.5 kb of DNA . 101–138 fibers per cell were quantified and shown as box and dot blots. P -value was obtained using the Mann–Whitney U test. F Replication fork asymmetry. Cells were treated as in (E). Representative fibers are shown. Fork asymmetry was determined by dividing longer biotin-dUTPs label on a bi-directional replication fork with shorter biotin-dUTPs label for 49-79 fibers per cell and shown as box and dot blots. P -value was obtained using the Mann–Whitney U test. In all the graphs, red, blue, or black-filled circles represent skin fibroblasts, while yellow-filled circles represent lung fibroblasts. Error bars represent S.D. DNA was stained with DAPI. Scale bars: 5 μm.
    Rabbit Polyclonal 53bp1 Cell Signaling Technology, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rabbit+polyclonal+anti+53bp1/53BP1+Antibody/pmc12370990__41467_2025_63083_MOESM1_ESM-61-70-73
    Average 96 stars, based on 1 article reviews
    rabbit polyclonal 53bp1 cell signaling technology - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    Image Search Results


    A Number of γ-H2AX foci. Cells were fixed and stained with an antibody against γ-H2AX. Representative images are shown. 15–24 cells for each cell were analyzed and displayed as box and dot plots in the right graph. Data from different cells are shown in different colors. P -value was obtained using the Mann-Whitney U -test. B Rates of cells with 53BP1 nuclear bodies. Cells were fixed and stained with an antibody against 53BP1. Representative images were shown (arrowheads). 95–138 cells for each cell were analyzed. P -value was obtained using the Welch’s t -test. C Rates of cells with ultrafine bridges. Cells were treated with RO-3306 for 12 h, released and fixed after 1 h, and stained with an antibody against PICH (ERCC6L). A representative image is shown (arrowheads). 46–66 cells were counted for each cell. P -value was obtained using the Student’s t -test. D Chromosome breaks were observed in 50–105 metaphase chromosome spreads for each cell. A representative image is shown (arrowhead). Percentages of cells with chromosome breaks were shown in the right graph. P -value was obtained using the Student’s t -test. E Replication fork speed. Cells were sequentially pulse-labeled with digoxigenin-conjugated deoxyuridine and biotin-conjugated deoxyuridine. Representative fibers are shown. Fork speeds were determined through the length of both labels (digoxigenin-dUTPs + biotin-dUTPs), according to the previous report that 1 μm is approximately equal to 3.5 kb of DNA . 101–138 fibers per cell were quantified and shown as box and dot blots. P -value was obtained using the Mann–Whitney U test. F Replication fork asymmetry. Cells were treated as in (E). Representative fibers are shown. Fork asymmetry was determined by dividing longer biotin-dUTPs label on a bi-directional replication fork with shorter biotin-dUTPs label for 49-79 fibers per cell and shown as box and dot blots. P -value was obtained using the Mann–Whitney U test. In all the graphs, red, blue, or black-filled circles represent skin fibroblasts, while yellow-filled circles represent lung fibroblasts. Error bars represent S.D. DNA was stained with DAPI. Scale bars: 5 μm.

    Journal: NPJ Aging

    Article Title: Human fibroblasts from aged individuals exhibit chromosomal instability through replication stress caused by oxidative stress

    doi: 10.1038/s41514-025-00299-w

    Figure Lengend Snippet: A Number of γ-H2AX foci. Cells were fixed and stained with an antibody against γ-H2AX. Representative images are shown. 15–24 cells for each cell were analyzed and displayed as box and dot plots in the right graph. Data from different cells are shown in different colors. P -value was obtained using the Mann-Whitney U -test. B Rates of cells with 53BP1 nuclear bodies. Cells were fixed and stained with an antibody against 53BP1. Representative images were shown (arrowheads). 95–138 cells for each cell were analyzed. P -value was obtained using the Welch’s t -test. C Rates of cells with ultrafine bridges. Cells were treated with RO-3306 for 12 h, released and fixed after 1 h, and stained with an antibody against PICH (ERCC6L). A representative image is shown (arrowheads). 46–66 cells were counted for each cell. P -value was obtained using the Student’s t -test. D Chromosome breaks were observed in 50–105 metaphase chromosome spreads for each cell. A representative image is shown (arrowhead). Percentages of cells with chromosome breaks were shown in the right graph. P -value was obtained using the Student’s t -test. E Replication fork speed. Cells were sequentially pulse-labeled with digoxigenin-conjugated deoxyuridine and biotin-conjugated deoxyuridine. Representative fibers are shown. Fork speeds were determined through the length of both labels (digoxigenin-dUTPs + biotin-dUTPs), according to the previous report that 1 μm is approximately equal to 3.5 kb of DNA . 101–138 fibers per cell were quantified and shown as box and dot blots. P -value was obtained using the Mann–Whitney U test. F Replication fork asymmetry. Cells were treated as in (E). Representative fibers are shown. Fork asymmetry was determined by dividing longer biotin-dUTPs label on a bi-directional replication fork with shorter biotin-dUTPs label for 49-79 fibers per cell and shown as box and dot blots. P -value was obtained using the Mann–Whitney U test. In all the graphs, red, blue, or black-filled circles represent skin fibroblasts, while yellow-filled circles represent lung fibroblasts. Error bars represent S.D. DNA was stained with DAPI. Scale bars: 5 μm.

    Article Snippet: For nucleoside supplementation, a mix of deoxycytidine (Tokyo Chemical Industry, D3583), deoxyadenosine (Tokyo Chemical Industry, D0046), thymidine (Tokyo Chemical Industry, T0233) and deoxyguanosine (Tokyo Chemical Industry, D0052) was applied at 20 μM for 48 h. Rabbit polyclonal antibodies for 53BP1 (NOVUS Biologicals, NB100-304) and PICH (ERCC6L; Proteintech, 15688-1-AP) were used for immunofluorescence at 1:1,000.

    Techniques: Staining, MANN-WHITNEY, Labeling

    A Number of γ-H2AX foci in the presence or absence of NAC. Cells were treated with NAC for 48 h, fixed, and stained with an antibody against γ-H2AX. Representative images are shown. 33-49 cells were analyzed for each cell and displayed as box and dot plots in the right graph. P -values were obtained using the Steel-Dwass multiple comparison test. B Rates of cells with 53BP1 nuclear bodies in the presence or absence of NAC. Cells were treated with NAC for 48 h, fixed, and stained with an antibody against 53BP1. 526-770 cells were analyzed for each cell. P -values were obtained using the Tukey–Kramer multiple comparison test. C Rates of cells with ultrafine bridges in the presence or absence of NAC. Cells were treated with NAC for 48 h and stained with an antibody against PICH (ERCC6L). DNA was stained with DAPI. 72-103 cells were counted for each cell. P -values were obtained using the Tukey–Kramer multiple comparison test. D Rates of cells with 53BP1 nuclear bodies in cells supplemented with or without nucleosides (NUC). Cells were supplemented with nucleosides for 48 h, fixed, and stained with an antibody against 53BP1. 401-890 cells were counted for each cell. P -values were obtained using the Tukey–Kramer multiple comparison test. E Rates of cells with ultrafine bridges in cells supplemented with or without nucleosides. Cells were treated as in ( D ). Then cells were fixed and stained with an antibody against PICH (ERCC6L). DNA was stained with DAPI. 39-70 cells were counted for each cell. P -values were obtained using the Tukey–Kramer multiple comparison test. F Micronucleation rates of cells supplemented with or without nucleosides. Cells were treated as in ( D ). Then cells were fixed and stained with DAPI. 521-741 cells were counted for each cell. P -values were obtained using the Tukey–Kramer multiple comparison test. In all the graphs, red, blue, or black-filled circles represent skin fibroblasts, while yellow-filled circles represent lung fibroblasts. Error bars represent S.D. n.s., not statistically significant. Scale bars: 5 μm.

    Journal: NPJ Aging

    Article Title: Human fibroblasts from aged individuals exhibit chromosomal instability through replication stress caused by oxidative stress

    doi: 10.1038/s41514-025-00299-w

    Figure Lengend Snippet: A Number of γ-H2AX foci in the presence or absence of NAC. Cells were treated with NAC for 48 h, fixed, and stained with an antibody against γ-H2AX. Representative images are shown. 33-49 cells were analyzed for each cell and displayed as box and dot plots in the right graph. P -values were obtained using the Steel-Dwass multiple comparison test. B Rates of cells with 53BP1 nuclear bodies in the presence or absence of NAC. Cells were treated with NAC for 48 h, fixed, and stained with an antibody against 53BP1. 526-770 cells were analyzed for each cell. P -values were obtained using the Tukey–Kramer multiple comparison test. C Rates of cells with ultrafine bridges in the presence or absence of NAC. Cells were treated with NAC for 48 h and stained with an antibody against PICH (ERCC6L). DNA was stained with DAPI. 72-103 cells were counted for each cell. P -values were obtained using the Tukey–Kramer multiple comparison test. D Rates of cells with 53BP1 nuclear bodies in cells supplemented with or without nucleosides (NUC). Cells were supplemented with nucleosides for 48 h, fixed, and stained with an antibody against 53BP1. 401-890 cells were counted for each cell. P -values were obtained using the Tukey–Kramer multiple comparison test. E Rates of cells with ultrafine bridges in cells supplemented with or without nucleosides. Cells were treated as in ( D ). Then cells were fixed and stained with an antibody against PICH (ERCC6L). DNA was stained with DAPI. 39-70 cells were counted for each cell. P -values were obtained using the Tukey–Kramer multiple comparison test. F Micronucleation rates of cells supplemented with or without nucleosides. Cells were treated as in ( D ). Then cells were fixed and stained with DAPI. 521-741 cells were counted for each cell. P -values were obtained using the Tukey–Kramer multiple comparison test. In all the graphs, red, blue, or black-filled circles represent skin fibroblasts, while yellow-filled circles represent lung fibroblasts. Error bars represent S.D. n.s., not statistically significant. Scale bars: 5 μm.

    Article Snippet: For nucleoside supplementation, a mix of deoxycytidine (Tokyo Chemical Industry, D3583), deoxyadenosine (Tokyo Chemical Industry, D0046), thymidine (Tokyo Chemical Industry, T0233) and deoxyguanosine (Tokyo Chemical Industry, D0052) was applied at 20 μM for 48 h. Rabbit polyclonal antibodies for 53BP1 (NOVUS Biologicals, NB100-304) and PICH (ERCC6L; Proteintech, 15688-1-AP) were used for immunofluorescence at 1:1,000.

    Techniques: Staining, Comparison

    A Cells were synchronized by RO-3306 for 12 h, released and treated with MG132 for 3 h, and either fixed directly or after cold treatment for 10 min. Cells were stained with an antibody against α-tubulin, and relative fluorescence intensity on the spindle at 10 min compared with that at 0 min was quantified for 5–7 cells for each cell. The average value of four young or old individuals at the time 0 is set to 1. P -value was obtained using the Student’s t -test. B Cells were treated with NAC for 48 h. Relative fluorescence intensity was quantified as in ( A ) for 10-24 cells for each cell. C Cells were supplemented with nucleosides for 48 h. Relative fluorescence intensity was quantified as in ( A ) for 10-27 cells for each cell. D Cells were treated with UMK57 for 24 h. Relative fluorescence intensity was quantified as in (A) for 10-28 cells for each cell. E Cells were treated with UMK57 for 24 h, fixed, and stained with DAPI. 251-534 cells were counted for each cell. The average value of four young or old individuals at the time 0 is set to 1. F Cells were treated as in ( D ), fixed, and stained with an antibody against γ-H2AX. 49-70 cells were analyzed for each cell and displayed as box and dot plots. P -values were obtained using the Steel-Dwass multiple comparison test. G Cells were treated as in ( D ), and fixed and stained with an antibody against 53BP1. 261-416 cells were analyzed for each cell. H Schematic of the mechanism of CIN in fibroblasts from aged individuals suggested in this study. See text for details. In all the graphs, red, blue, or black-filled circles represent skin fibroblasts, while yellow-filled circles represent lung fibroblasts. In ( B ), ( C ), ( D ), ( E ), and ( G ), P -values were obtained using the Tukey–Kramer multiple comparison test. Error bars represent S.D. n.s., not statistically significant. Scale bars: 5 μm.

    Journal: NPJ Aging

    Article Title: Human fibroblasts from aged individuals exhibit chromosomal instability through replication stress caused by oxidative stress

    doi: 10.1038/s41514-025-00299-w

    Figure Lengend Snippet: A Cells were synchronized by RO-3306 for 12 h, released and treated with MG132 for 3 h, and either fixed directly or after cold treatment for 10 min. Cells were stained with an antibody against α-tubulin, and relative fluorescence intensity on the spindle at 10 min compared with that at 0 min was quantified for 5–7 cells for each cell. The average value of four young or old individuals at the time 0 is set to 1. P -value was obtained using the Student’s t -test. B Cells were treated with NAC for 48 h. Relative fluorescence intensity was quantified as in ( A ) for 10-24 cells for each cell. C Cells were supplemented with nucleosides for 48 h. Relative fluorescence intensity was quantified as in ( A ) for 10-27 cells for each cell. D Cells were treated with UMK57 for 24 h. Relative fluorescence intensity was quantified as in (A) for 10-28 cells for each cell. E Cells were treated with UMK57 for 24 h, fixed, and stained with DAPI. 251-534 cells were counted for each cell. The average value of four young or old individuals at the time 0 is set to 1. F Cells were treated as in ( D ), fixed, and stained with an antibody against γ-H2AX. 49-70 cells were analyzed for each cell and displayed as box and dot plots. P -values were obtained using the Steel-Dwass multiple comparison test. G Cells were treated as in ( D ), and fixed and stained with an antibody against 53BP1. 261-416 cells were analyzed for each cell. H Schematic of the mechanism of CIN in fibroblasts from aged individuals suggested in this study. See text for details. In all the graphs, red, blue, or black-filled circles represent skin fibroblasts, while yellow-filled circles represent lung fibroblasts. In ( B ), ( C ), ( D ), ( E ), and ( G ), P -values were obtained using the Tukey–Kramer multiple comparison test. Error bars represent S.D. n.s., not statistically significant. Scale bars: 5 μm.

    Article Snippet: For nucleoside supplementation, a mix of deoxycytidine (Tokyo Chemical Industry, D3583), deoxyadenosine (Tokyo Chemical Industry, D0046), thymidine (Tokyo Chemical Industry, T0233) and deoxyguanosine (Tokyo Chemical Industry, D0052) was applied at 20 μM for 48 h. Rabbit polyclonal antibodies for 53BP1 (NOVUS Biologicals, NB100-304) and PICH (ERCC6L; Proteintech, 15688-1-AP) were used for immunofluorescence at 1:1,000.

    Techniques: Staining, Fluorescence, Comparison